Clone Assay:Article Title: Nucleoplasmic Lamin A/C controls replication fork restart upon stress by modulating local H3K9me3 and ADP-ribosylation levels.
Article Snippet: .. The gRNA was cloned into the CRISPR-Cas9 containing plasmid pX330 (Addgene Cat # 42230-DNA.cg) according to Ann et al. 2016, using the following oligos for the N-terminal region: 5’-CGCTGCCAACCTGCCGGCCA-3’ (CRISPR gRNA) and 5’-TGGCCGGCAGGTTGGCAGCG-3’ (reverse complement). .. For the donor plasmid, we used HCT116 genomic DNA to amplify by PCR and clone into the pJET plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific Cat # K1232) a 1kb fragment as homology arms (HAs) at the N-terminus of the LMNA gene containing the first ATG codon, using the following oligos: 5’- CACCCACTCTCCCTCCTTGG-3’ (forward primer) and 5’-GCCCCAACTTGTCCCTGATAC-3’ (reverse primer).
CRISPR:Article Title: Nucleoplasmic Lamin A/C controls replication fork restart upon stress by modulating local H3K9me3 and ADP-ribosylation levels.
Article Snippet: .. The gRNA was cloned into the CRISPR-Cas9 containing plasmid pX330 (Addgene Cat # 42230-DNA.cg) according to Ann et al. 2016, using the following oligos for the N-terminal region: 5’-CGCTGCCAACCTGCCGGCCA-3’ (CRISPR gRNA) and 5’-TGGCCGGCAGGTTGGCAGCG-3’ (reverse complement). .. For the donor plasmid, we used HCT116 genomic DNA to amplify by PCR and clone into the pJET plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific Cat # K1232) a 1kb fragment as homology arms (HAs) at the N-terminus of the LMNA gene containing the first ATG codon, using the following oligos: 5’- CACCCACTCTCCCTCCTTGG-3’ (forward primer) and 5’-GCCCCAACTTGTCCCTGATAC-3’ (reverse primer).
Article Title: Nucleoplasmic Lamin A/C controls replication fork restart upon stress by modulating local H3K9me3 and ADP-ribosylation levels
Article Snippet: .. The gRNA was cloned into the CRISPR-Cas9 containing plasmid pX330 (Addgene Cat # 42230-DNA.cg) according to Ann et al. 2016, using the following oligos for the N-terminal region: 5′-CGCTGCCAACCTGCCGGCCA-3′ (CRISPR gRNA) and 5′-TGGCCGGCAGGTTGGCAGCG-3′ (reverse complement). .. For the donor plasmid, we used HCT116 genomic DNA to amplify by PCR and clone into the pJET plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific Cat # K1232) a 1 kb fragment as homology arms (HAs) at the N-terminus of the LMNA gene containing the first ATG codon, using the following oligos: 5′-CACCCACTCTCCCTCCTTGG-3′ (forward primer) and 5′-GCCCCAACTTGTCCCTGATAC-3′ (reverse primer).
Plasmid Preparation:Article Title: Nucleoplasmic Lamin A/C controls replication fork restart upon stress by modulating local H3K9me3 and ADP-ribosylation levels.
Article Snippet: .. The gRNA was cloned into the CRISPR-Cas9 containing plasmid pX330 (Addgene Cat # 42230-DNA.cg) according to Ann et al. 2016, using the following oligos for the N-terminal region: 5’-CGCTGCCAACCTGCCGGCCA-3’ (CRISPR gRNA) and 5’-TGGCCGGCAGGTTGGCAGCG-3’ (reverse complement). .. For the donor plasmid, we used HCT116 genomic DNA to amplify by PCR and clone into the pJET plasmid (CloneJET PCR Cloning Kit, Thermo Fisher Scientific Cat # K1232) a 1kb fragment as homology arms (HAs) at the N-terminus of the LMNA gene containing the first ATG codon, using the following oligos: 5’- CACCCACTCTCCCTCCTTGG-3’ (forward primer) and 5’-GCCCCAACTTGTCCCTGATAC-3’ (reverse primer).
Article Title: A CARMIL2 gain-of-function mutation suffices to trigger most CD28 costimulatory functions in vivo
Article Snippet: .. Each pair of oligonucleotides contained CACC and AACC overhangs for cloning into BbsI sites of plasmid pX330 (pSpCas9; plasmid ID 42230; Addgene), and a G-C base pair (italics) was added at the 5′ end of the guide sequence for T7 transcription. .. A 4932-bp-long double-stranded DNA (dsDNA) HDR template denoted Carmil2_exons_19-39_OST_P2A_Neo R was designed and purchased from Integrated DNA Technologies as a plasmid vector.
Article Title: Engineered chromatin readers track damaged chromatin dynamics in live cells and animals
Article Snippet: .. To generate the construct expressing the catalytic dead Cas9 (dCas9), the DNA sequence from the plasmid pdCas9 (Addgene 46569) was Gibson assembled into the EcoRI and AgeI sites of the plasmid PX330 (Addgene 42230). .. Small guide RNAs (sgRNAs) sequences targeting murine major satellite repeats (MSRs) are from ref. sgRNA#1:GGCGAGAAAACTGAAAATCA; sgRNA#2:GCGAGGAAAACTGAAAAAGG; sgRNA#3: GAAATGTCCACTGTAGGACG, and were cloned onto pX330 plasmid (Addgene 42230) or pX330-dCas9 according to ref. . sgRNAs sequences targeting single (GCCGATGGTGAAGTGGTAAG) - or 4 (TGGACTGCAGTACACAATCA) copy loci in the human iCut-RPE-derived cells are from ref. and were cloned into the pX458-Dual-Guide-Donor-ShuttleOnly (Addgene 171098), as described above.
Article Title: Engineered chromatin readers track damaged chromatin dynamics in live cells and animals.
Article Snippet: .. To generate the construct expressing the catalytic dead Cas9 (dCas9), the DNA sequence from the plasmid pdCas9 (Addgene 46569) was Gibson assembled into the EcoRI and AgeI sites of the plasmid PX330 (Addgene 42230). .. Small guide RNAs (sgRNAs) sequences targeting murine major satellite repeats (MSRs) are from ref. 29 sgRNA#1:GGCGAGAAAACTGAAAATCA; sgRNA#2:GCGAGGAAAACTGAAAAAGG; sgRNA#3: GAAATGTCCACTGTAGGACG, and were cloned onto pX330 plasmid (Addgene 42230) or pX330-dCas9 according to ref. 42. sgRNAs sequences targeting single (GCCGATGGTGAAGTGGTAAG) - or 4 (TGGACTGCAGTACACAATCA) copy loci in the human iCut-RPE-derived cells are from ref. 27 andwere cloned into the pX458-Dual-Guide-Donor-ShuttleOnly (Addgene 171098), as described above.
Cloning:Article Title: A CARMIL2 gain-of-function mutation suffices to trigger most CD28 costimulatory functions in vivo
Article Snippet: .. Each pair of oligonucleotides contained CACC and AACC overhangs for cloning into BbsI sites of plasmid pX330 (pSpCas9; plasmid ID 42230; Addgene), and a G-C base pair (italics) was added at the 5′ end of the guide sequence for T7 transcription. .. A 4932-bp-long double-stranded DNA (dsDNA) HDR template denoted Carmil2_exons_19-39_OST_P2A_Neo R was designed and purchased from Integrated DNA Technologies as a plasmid vector.
Sequencing:Article Title: A CARMIL2 gain-of-function mutation suffices to trigger most CD28 costimulatory functions in vivo
Article Snippet: .. Each pair of oligonucleotides contained CACC and AACC overhangs for cloning into BbsI sites of plasmid pX330 (pSpCas9; plasmid ID 42230; Addgene), and a G-C base pair (italics) was added at the 5′ end of the guide sequence for T7 transcription. .. A 4932-bp-long double-stranded DNA (dsDNA) HDR template denoted Carmil2_exons_19-39_OST_P2A_Neo R was designed and purchased from Integrated DNA Technologies as a plasmid vector.
Article Title: Engineered chromatin readers track damaged chromatin dynamics in live cells and animals
Article Snippet: .. To generate the construct expressing the catalytic dead Cas9 (dCas9), the DNA sequence from the plasmid pdCas9 (Addgene 46569) was Gibson assembled into the EcoRI and AgeI sites of the plasmid PX330 (Addgene 42230). .. Small guide RNAs (sgRNAs) sequences targeting murine major satellite repeats (MSRs) are from ref. sgRNA#1:GGCGAGAAAACTGAAAATCA; sgRNA#2:GCGAGGAAAACTGAAAAAGG; sgRNA#3: GAAATGTCCACTGTAGGACG, and were cloned onto pX330 plasmid (Addgene 42230) or pX330-dCas9 according to ref. . sgRNAs sequences targeting single (GCCGATGGTGAAGTGGTAAG) - or 4 (TGGACTGCAGTACACAATCA) copy loci in the human iCut-RPE-derived cells are from ref. and were cloned into the pX458-Dual-Guide-Donor-ShuttleOnly (Addgene 171098), as described above.
Article Title: Engineered chromatin readers track damaged chromatin dynamics in live cells and animals.
Article Snippet: .. To generate the construct expressing the catalytic dead Cas9 (dCas9), the DNA sequence from the plasmid pdCas9 (Addgene 46569) was Gibson assembled into the EcoRI and AgeI sites of the plasmid PX330 (Addgene 42230). .. Small guide RNAs (sgRNAs) sequences targeting murine major satellite repeats (MSRs) are from ref. 29 sgRNA#1:GGCGAGAAAACTGAAAATCA; sgRNA#2:GCGAGGAAAACTGAAAAAGG; sgRNA#3: GAAATGTCCACTGTAGGACG, and were cloned onto pX330 plasmid (Addgene 42230) or pX330-dCas9 according to ref. 42. sgRNAs sequences targeting single (GCCGATGGTGAAGTGGTAAG) - or 4 (TGGACTGCAGTACACAATCA) copy loci in the human iCut-RPE-derived cells are from ref. 27 andwere cloned into the pX458-Dual-Guide-Donor-ShuttleOnly (Addgene 171098), as described above.
Construct:Article Title: Engineered chromatin readers track damaged chromatin dynamics in live cells and animals
Article Snippet: .. To generate the construct expressing the catalytic dead Cas9 (dCas9), the DNA sequence from the plasmid pdCas9 (Addgene 46569) was Gibson assembled into the EcoRI and AgeI sites of the plasmid PX330 (Addgene 42230). .. Small guide RNAs (sgRNAs) sequences targeting murine major satellite repeats (MSRs) are from ref. sgRNA#1:GGCGAGAAAACTGAAAATCA; sgRNA#2:GCGAGGAAAACTGAAAAAGG; sgRNA#3: GAAATGTCCACTGTAGGACG, and were cloned onto pX330 plasmid (Addgene 42230) or pX330-dCas9 according to ref. . sgRNAs sequences targeting single (GCCGATGGTGAAGTGGTAAG) - or 4 (TGGACTGCAGTACACAATCA) copy loci in the human iCut-RPE-derived cells are from ref. and were cloned into the pX458-Dual-Guide-Donor-ShuttleOnly (Addgene 171098), as described above.
Article Title: Engineered chromatin readers track damaged chromatin dynamics in live cells and animals.
Article Snippet: .. To generate the construct expressing the catalytic dead Cas9 (dCas9), the DNA sequence from the plasmid pdCas9 (Addgene 46569) was Gibson assembled into the EcoRI and AgeI sites of the plasmid PX330 (Addgene 42230). .. Small guide RNAs (sgRNAs) sequences targeting murine major satellite repeats (MSRs) are from ref. 29 sgRNA#1:GGCGAGAAAACTGAAAATCA; sgRNA#2:GCGAGGAAAACTGAAAAAGG; sgRNA#3: GAAATGTCCACTGTAGGACG, and were cloned onto pX330 plasmid (Addgene 42230) or pX330-dCas9 according to ref. 42. sgRNAs sequences targeting single (GCCGATGGTGAAGTGGTAAG) - or 4 (TGGACTGCAGTACACAATCA) copy loci in the human iCut-RPE-derived cells are from ref. 27 andwere cloned into the pX458-Dual-Guide-Donor-ShuttleOnly (Addgene 171098), as described above.
Expressing:Article Title: Engineered chromatin readers track damaged chromatin dynamics in live cells and animals
Article Snippet: .. To generate the construct expressing the catalytic dead Cas9 (dCas9), the DNA sequence from the plasmid pdCas9 (Addgene 46569) was Gibson assembled into the EcoRI and AgeI sites of the plasmid PX330 (Addgene 42230). .. Small guide RNAs (sgRNAs) sequences targeting murine major satellite repeats (MSRs) are from ref. sgRNA#1:GGCGAGAAAACTGAAAATCA; sgRNA#2:GCGAGGAAAACTGAAAAAGG; sgRNA#3: GAAATGTCCACTGTAGGACG, and were cloned onto pX330 plasmid (Addgene 42230) or pX330-dCas9 according to ref. . sgRNAs sequences targeting single (GCCGATGGTGAAGTGGTAAG) - or 4 (TGGACTGCAGTACACAATCA) copy loci in the human iCut-RPE-derived cells are from ref. and were cloned into the pX458-Dual-Guide-Donor-ShuttleOnly (Addgene 171098), as described above.
Article Title: Engineered chromatin readers track damaged chromatin dynamics in live cells and animals.
Article Snippet: .. To generate the construct expressing the catalytic dead Cas9 (dCas9), the DNA sequence from the plasmid pdCas9 (Addgene 46569) was Gibson assembled into the EcoRI and AgeI sites of the plasmid PX330 (Addgene 42230). .. Small guide RNAs (sgRNAs) sequences targeting murine major satellite repeats (MSRs) are from ref. 29 sgRNA#1:GGCGAGAAAACTGAAAATCA; sgRNA#2:GCGAGGAAAACTGAAAAAGG; sgRNA#3: GAAATGTCCACTGTAGGACG, and were cloned onto pX330 plasmid (Addgene 42230) or pX330-dCas9 according to ref. 42. sgRNAs sequences targeting single (GCCGATGGTGAAGTGGTAAG) - or 4 (TGGACTGCAGTACACAATCA) copy loci in the human iCut-RPE-derived cells are from ref. 27 andwere cloned into the pX458-Dual-Guide-Donor-ShuttleOnly (Addgene 171098), as described above.
other:Article Title: Plasticity of mitotic cyclins in promoting the G 2 –M transition
Article Snippet: CRISPR-Cas9 plasmids were generated by annealing the indicated pairs of oligonucleotides followed by ligation into BbsI-cut pX330 (a gift from Feng Zhang; obtained from Addgene; #42230; Addgene): cyclin A (5′-CAC CGC AGT ATG AGA GCT ATC CTC G-3′ and 5′-AAA CCG AGG ATA GCT CTC ATA CTG C-3′); cyclin B1 (5′-CAC CGC CTA ATT GAC TGG CTA GTA C-3′ and 5′-AAA CGT ACT AGC CAG TCA ATT AGG C-3′); and cyclin B2 (5′-CAC CGA GAC TCT GTA CAT GTG CGT-3′ and 5′-AAA CAC GCA CAT GTA CAG AGT CTC-3′).
|
Addgene inc is a verified supplier 